Top » Catalog » SNPs » A16335

$19.00

A16335
[A16335]

A16335
hg38 Position: ChrY:8068280..8068288
Ancestral: del
Derived: ins
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397
Forward Primer: A16335_F TGTCATATCACTGGGCCAAC
Reverse Primer: A16335_R TGGCACCACGTCTATGGTAG
Reviews

Customers who bought this product also purchased
A17692
A17692
A16333
A16333
A16332
A16332
A16331
A16331
A16155
A16155
A16154
A16154
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies