Top » Catalog » SNPs » A16337

$18.00

A16337
[A16337]

A16337
hg38 Position: ChrY:12233744..12233744
Ancestral: G
Derived: T
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Below Y13373
Forward Primer: A16337_F GCTGGGGACATACTTCATCC
Reverse Primer: A16337_R CATGCCATCCCAGTTAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies