Top » Catalog » SNPs » Z5891

$18.00

Z5891
[Z5891]

Z5891
hg38 Position: ChrY:7871413..7871413
Ancestral: A
Derived: G
Reference: Ray Banks (2013)
ISOGG Haplogroup: H1a1a4b3b1a (not listed)
Comments: Downstream of Z5890, peer to CTS8144/M5498
Forward Primer: Z5891_F CAAAGAAAGCAGGGTGCAG
Reverse Primer: Z5891_R CAAATTTCTGCCCAGAGAAAG
Reviews

Customers who bought this product also purchased
SK1225
SK1225
CTS8144
CTS8144
Z5888
Z5888
Z4507
Z4507
M2854
M2854
Z34531
Z34531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies