Top » Catalog » SNPs » Z5891

$18.00

Z5891
[Z5891]

Z5891
hg38 Position: ChrY:7871413..7871413
Ancestral: A
Derived: G
Reference: Ray Banks (2013)
ISOGG Haplogroup: H1a1a4b3b1a (not listed)
Comments: Downstream of Z5890, peer to CTS8144/M5498
Forward Primer: Z5891_F CAAAGAAAGCAGGGTGCAG
Reverse Primer: Z5891_R CAAATTTCTGCCCAGAGAAAG
Reviews

Customers who bought this product also purchased
Z5888
Z5888
Z4507
Z4507
M2854
M2854
Z34531
Z34531
H-M82 Panel
H-M82 Panel
Z34526
Z34526
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies