Top » Catalog » SNPs » M2854

$18.00

M2854
[M2854]

M2854
hg38 Position: ChrY:13636950..13636950
Ancestral: G
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: H1a1a4b2
Comments: Below SK1225
Forward Primer: M2854v2_F GGAGATCTTTTCTGTCTGGCC
Reverse Primer: M2854v2_R TCTCACTGACTCCAGGAGTGAG
Reviews

Customers who bought this product also purchased
M96
M96
L901
L901
M267
M267
L1089
L1089
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M201
M201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies