Top » Catalog » SNPs » Y25776

$18.00

Y25776
[Y25776]

Y25776
hg38 Position: ChrY:8565626..8565626
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: H1a1a4b1 (not listed)
Comments: Approx below Z5873 and above Z34637
Forward Primer: Y25776_F CATCTGAGCTGGTGCTTCAC
Reverse Primer: Y25776_R TGAGCCAGACCCATAAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies