Top » Catalog » SNPs » FGC19319

$35.00

FGC19319
[FGC19319]

FGC19319
hg38 Position: ChrY:2665405..2665405
Ancestral: T
Derived: A
Reference:
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19319v2_F AGGCTCACCTCAACCTTGAC
Reverse Primer: FGC19319v2_R ATTAGCCACTGGGCCCAG
Reviews

Customers who bought this product also purchased
FGC19349
FGC19349
FGC19335
FGC19335
FGC19357
FGC19357
FGC19343
FGC19343
S23106
S23106
FGC19348
FGC19348
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies