Top » Catalog » SNPs » FGC19319

$35.00

FGC19319
[FGC19319]

FGC19319
hg38 Position: ChrY:2665405..2665405
Ancestral: T
Derived: A
Reference:
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19319v2_F AGGCTCACCTCAACCTTGAC
Reverse Primer: FGC19319v2_R ATTAGCCACTGGGCCCAG
Reviews

Customers who bought this product also purchased
FGC19329
FGC19329
FGC19356
FGC19356
FGC19339
FGC19339
M3846
M3846
FGC19347
FGC19347
R1b-FGC5494 > FGC19329
R1b-FGC5494 > FGC19329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies