Top » Catalog » SNPs » Z4490

$18.00

Z4490
[Z4490]

Z4490
hg38 Position: ChrY:2997075..2997075
Ancestral: del
Derived: ins
Reference: Community
ISOGG Haplogroup: H1a1a4b (not listed)
Comments: Below SK1225, peer to M2854
Forward Primer: Z4490_F CATATAGGCAATGGGCAGAC
Reverse Primer: Z4490_R CCAACTTTCTAGTCCAATTGAGG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies