Top » Catalog » SNPs » Z4490

$18.00

Z4490
[Z4490]

Z4490
hg38 Position: ChrY:2997075..2997075
Ancestral: del
Derived: ins
Reference: Community
ISOGG Haplogroup: H1a1a4b (not listed)
Comments: Below SK1225, peer to M2854
Forward Primer: Z4490_F CATATAGGCAATGGGCAGAC
Reverse Primer: Z4490_R CCAACTTTCTAGTCCAATTGAGG
Reviews

Customers who bought this product also purchased
M172
M172
FGC2366
FGC2366
M96
M96
L901
L901
M267
M267
L1089
L1089
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies