Top » Catalog » SNPs » Z5888

$18.00

Z5888
[Z5888]

Z5888
hg38 Position: ChrY:13270903..13270903
Ancestral: A
Derived: C
Reference: Ray Banks (2013)
ISOGG Haplogroup: H1a1a4b3b
Comments: Downstream of Z4507
Forward Primer: Z5888_F TCTATGCCACACCCCTTTTG
Reverse Primer: Z5888_R GTCACCCAGGCTTATGTGC
Reviews

Customers who bought this product also purchased
Z4507
Z4507
M2854
M2854
Z34531
Z34531
H-M82 Panel
H-M82 Panel
Z34526
Z34526
SK1225
SK1225
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies