Top » Catalog » SNPs » FGC19329

$18.00

FGC19329
[FGC19329]

FGC19329
hg38 Position: ChrY:6917827..6917827
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19329_F GGTGTCACAGTGGACAATGG
Reverse Primer: FGC19329_R ACTTCAAAGAGGGCCTCCAC
Reviews

Customers who bought this product also purchased
A1149
A1149
L21
L21
U152
U152
A7763
A7763
P312
P312
A7759
A7759
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies