Top » Catalog » SNPs » FGC19335

$18.00

FGC19335
[FGC19335]

FGC19335
hg38 Position: ChrY:8012147..8012147
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19335_F CCTCTGTTATGAAACCCTTTGTC
Reverse Primer: FGC19335_R AAAGTGCTGCAATTACACACATG
Reviews

Customers who bought this product also purchased
FGC19343
FGC19343
S23106
S23106
FGC19348
FGC19348
R1b-FGC5494 > FGC19329
R1b-FGC5494 > FGC19329
FGC19356
FGC19356
FGC19339
FGC19339
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies