Top » Catalog » SNPs » FGC19338

$18.00

FGC19338
[FGC19338]

FGC19338
hg38 Position: ChrY:8977633..8977633
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19338_F TCAGTTTGCTGTCCATAAGAGACTAG
Reverse Primer: FGC19338_R GATTTCACAGTCAGAGTGGAGG
Reviews

Customers who bought this product also purchased
FGC19347
FGC19347
FGC19355
FGC19355
FGC19337
FGC19337
FGC19365
FGC19365
FGC19346
FGC19346
FGC19353
FGC19353
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies