Top » Catalog » SNPs » FGC19343

$18.00

FGC19343
[FGC19343]

FGC19343
hg38 Position: ChrY:13435642..13435642
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19343_F CGCACATTCCTGTCGTTC
Reverse Primer: FGC19343_R CGCCTAAGAACTGGGTCTCC
Reviews

Customers who bought this product also purchased
FGC19329
FGC19329
FGC19357
FGC19357
FGC19339
FGC19339
S23106
S23106
FGC19348
FGC19348
R1b-FGC5494 > FGC19329
R1b-FGC5494 > FGC19329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies