Top » Catalog » SNPs » FGC19347

$18.00

FGC19347
[FGC19347]

FGC19347
hg38 Position: ChrY:14452229..14452229
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19347_F GCAGTGCTCTGCTACCACTAGG
Reverse Primer: FGC19347_R TCAGATGGCATCAGGCAAG
Reviews

Customers who bought this product also purchased
FGC19346
FGC19346
FGC19355
FGC19355
FGC19337
FGC19337
FGC19365
FGC19365
FGC19345
FGC19345
FGC19353
FGC19353
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies