Top » Catalog » SNPs » FGC19353

$18.00

FGC19353
[FGC19353]

FGC19353
hg38 Position: ChrY:15738145..15738145
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19353_F ATGCAATGCACATGTATGTTTG
Reverse Primer: FGC19353_R AACATTCCAATCTCTGTGATTGTC
Reviews

Customers who bought this product also purchased
FGC19346
FGC19346
R1b-FGC5494 > FGC19329
R1b-FGC5494 > FGC19329
FGC19355
FGC19355
FGC19337
FGC19337
FGC19365
FGC19365
FGC19345
FGC19345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies