Top » Catalog » SNPs » FGC19353

$18.00

FGC19353
[FGC19353]

FGC19353
hg38 Position: ChrY:15738145..15738145
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19353_F ATGCAATGCACATGTATGTTTG
Reverse Primer: FGC19353_R AACATTCCAATCTCTGTGATTGTC
Reviews

Customers who bought this product also purchased
FGC19329
FGC19329
FGC19357
FGC19357
FGC19339
FGC19339
S23106
S23106
FGC19347
FGC19347
FGC19319
FGC19319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies