Top » Catalog » SNPs » FGC19355

$18.00

FGC19355
[FGC19355]

FGC19355
hg38 Position: ChrY:16969344..16969344
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19355_F GACAAGACAATGTGCCAAAGTC
Reverse Primer: FGC19355_R CCACATATCTACAACCATCTTACCTC
Reviews

Customers who bought this product also purchased
R1b-FGC5494 > FGC19329
R1b-FGC5494 > FGC19329
FGC19356
FGC19356
FGC19338
FGC19338
M3846
M3846
FGC19346
FGC19346
FGC19353
FGC19353
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies