Top » Catalog » SNPs » FGC19358

$18.00

FGC19358
[FGC19358]

FGC19358
hg38 Position: ChrY:20000359..20000359
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19358_F AAAATACAGACTGCAAGCACTCAC
Reverse Primer: FGC19358_R CTCCCAGAAAAGATTCAAGGC
Reviews

Customers who bought this product also purchased
FGC19347
FGC19347
FGC19355
FGC19355
R1b-FGC5494 > FGC19329
R1b-FGC5494 > FGC19329
FGC19338
FGC19338
M3846
M3846
FGC19346
FGC19346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies