Top » Catalog » SNPs » FGC19365

$18.00

FGC19365
[FGC19365]

FGC19365
hg38 Position: ChrY:15870731..15870733
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19365_F TGCCAGACCTACTCTAAAGGTCC
Reverse Primer: FGC19365_R AAAGTCGAGTGGAATTTTCTTCTG
Reviews

Customers who bought this product also purchased
FGC19347
FGC19347
R1b-FGC5494 > FGC19329
R1b-FGC5494 > FGC19329
FGC19355
FGC19355
FGC19338
FGC19338
M3846
M3846
FGC19346
FGC19346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies