Top » Catalog » SNPs » FGC19365

$18.00

FGC19365
[FGC19365]

FGC19365
hg38 Position: ChrY:15870731..15870733
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: FGC19365_F TGCCAGACCTACTCTAAAGGTCC
Reverse Primer: FGC19365_R AAAGTCGAGTGGAATTTTCTTCTG
Reviews

Customers who bought this product also purchased
FGC19337
FGC19337
FGC19359
FGC19359
FGC19345
FGC19345
FGC19350
FGC19350
FGC19336
FGC19336
FGC19358
FGC19358
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies