Top » Catalog » SNPs » M3846

$18.00

M3846
[M3846]

M3846
hg38 Position: ChrY:20907568..20907568
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: M3846_F CAAAATATACCCAACAATTCAGTTTC
Reverse Primer: M3846_R CCCTATGATTGACTTGCAAACTAC
Reviews

Customers who bought this product also purchased
FGC19336
FGC19336
FGC19358
FGC19358
FGC19344
FGC19344
FGC19349
FGC19349
FGC19335
FGC19335
FGC19357
FGC19357
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies