Top » Catalog » SNPs » DF19

$18.00

DF19
[DF19]

DF19
hg38 Position: ChrY:12180793..12180793
Ancestral: G
Derived: T
Reference: dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2e
Comments: Downstream R-P312 parallel to Z195 Z196
Forward Primer: DF19v2_F GATCTGCAACTCCCTTCCAC
Reverse Primer: DF19v2_R CAGCTGCTGTCTGTCACTCC
Reviews

Customers who bought this product also purchased
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF41
DF41
Z56
Z56
L1335
L1335
L20
L20
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Gamma
1 x YSEQ-Beta
1 x mtComplete
1 x HVR2
1 x HVR1
1 x mtUpgrade
$483.00
Haplogroup Info
Other products
Currencies