Top » Catalog » SNPs » DF19

$18.00

DF19
[DF19]

DF19
hg38 Position: ChrY:12180793..12180793
Ancestral: G
Derived: T
Reference: dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2e
Comments: Downstream R-P312 parallel to Z195 Z196
Forward Primer: DF19v2_F GATCTGCAACTCCCTTCCAC
Reverse Primer: DF19v2_R CAGCTGCTGTCTGTCACTCC
Reviews

Customers who bought this product also purchased
R1b-DF19 Panel
R1b-DF19 Panel
S4268
S4268
DF88
DF88
S17075
S17075
Z40619
Z40619
S7449
S7449
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies