Top » Catalog » SNPs » DF19

$18.00

DF19
[DF19]

DF19
hg38 Position: ChrY:12180793..12180793
Ancestral: G
Derived: T
Reference: dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2e
Comments: Downstream R-P312 parallel to Z195 Z196
Forward Primer: DF19v2_F GATCTGCAACTCCCTTCCAC
Reverse Primer: DF19v2_R CAGCTGCTGTCTGTCACTCC
Reviews

Customers who bought this product also purchased
FGC20761
FGC20761
Y31385
Y31385
M70
M70
Y63240
Y63240
M172
M172
Y36418
Y36418
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies