Top » Catalog » SNPs » DF19

$18.00

DF19
[DF19]

DF19
hg38 Position: ChrY:12180793..12180793
Ancestral: G
Derived: T
Reference: dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2e
Comments: Downstream R-P312 parallel to Z195 Z196
Forward Primer: DF19v2_F GATCTGCAACTCCCTTCCAC
Reverse Primer: DF19v2_R CAGCTGCTGTCTGTCACTCC
Reviews

Customers who bought this product also purchased
Y17161
Y17161
BY3550
BY3550
Z192
Z192
PF6645
PF6645
L145
L145
S8024
S8024
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies