Top » Catalog » SNPs » DF19

$15.00

DF19
[DF19]

DF19
hg38 Position: ChrY:12180793..12180793
Ancestral: G
Derived: T
Reference: dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2e
Comments: Downstream R-P312 parallel to Z195 Z196
Forward Primer: DF19v2_F GATCTGCAACTCCCTTCCAC
Reverse Primer: DF19v2_R CAGCTGCTGTCTGTCACTCC
Reviews

Customers who bought this product also purchased
A275
A275
L145
L145
FGC5058
FGC5058
S8024
S8024
PF6608
PF6608
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies