Top » Catalog » SNPs » U152

$18.00

U152
[U152]

U152
hg38 Position: ChrY:13221267..13221267
Ancestral: C
Derived: T
Reference: Sims et al. 2007
ISOGG Haplogroup: R1b1a1a2a1a2b
Comments: aka S28
Forward Primer: U152v2_F TTAGCTATACAGCCTCTTTTTGGC
Reverse Primer: U152v2_R ACTTCAGCAACATCTCAGGATATG
Reviews

Customers who bought this product also purchased
HVR1
HVR1
BY32412
BY32412
L278
L278
L1345
L1345
A7993
A7993
FGC71023
FGC71023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies