Top » Catalog » SNPs » U152

$18.00

U152
[U152]

U152
hg38 Position: ChrY:13221267..13221267
Ancestral: C
Derived: T
Reference: Sims et al. 2007
ISOGG Haplogroup: R1b1a1a2a1a2b
Comments: aka S28
Forward Primer: U152v2_F TTAGCTATACAGCCTCTTTTTGGC
Reverse Primer: U152v2_R ACTTCAGCAACATCTCAGGATATG
Reviews

Customers who bought this product also purchased
Z17125
Z17125
S17075
S17075
Z40619
Z40619
S7449
S7449
Z17126
Z17126
DYS390
DYS390
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies