Top » Catalog » SNPs » A749

$18.00

A749
[A749]

A749
hg38 Position: ChrY:7231301..7231301
Ancestral: T
Derived: G
Reference: Desideriu Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF41
Forward Primer: A749_F GTTTGAGATGGAGTTTTGCTTG
Reverse Primer: A749_R GAACTTCTGACTTACAGAAATATAAGAGTGC
Reviews

Customers who bought this product also purchased
A40
A40
Y14198
Y14198
S775
S775
Y14197
Y14197
DF41
DF41
Z17582
Z17582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies