Top » Catalog » SNPs » A751

$18.00

A751
[A751]

A751
hg38 Position: ChrY:19544752..19544752
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L257 > A750
Forward Primer: A751_F TCTCAGACACCAATGGTCCTATC
Reverse Primer: A751_R AAATCTTTAGGAACTTCAGGTACAGC
Reviews

Customers who bought this product also purchased
A752
A752
A750
A750
FGC14794
FGC14794
A12280
A12280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies