Top » Catalog » SNPs » DF23

$18.00

DF23
[DF23]

DF23
hg38 Position: ChrY:15662529..15662529
Ancestral: G
Derived: A
Reference: Andy Gierson
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1
Comments: downstream of R-DF49. upstream of R-M222
Forward Primer: DF23_F GCATAGTCTCTCTGTCTGTCATCC
Reverse Primer: DF23_R AACCACCATTACGTGCATATACC
Reviews

Customers who bought this product also purchased
FGC20797
FGC20797
A13152
A13152
ZP179
ZP179
FGC20770
FGC20770
DF49
DF49
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies