Top » Catalog » SNPs » DF23

$18.00

DF23
[DF23]

DF23
hg38 Position: ChrY:15662529..15662529
Ancestral: G
Derived: A
Reference: Andy Gierson
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1
Comments: downstream of R-DF49. upstream of R-M222
Forward Primer: DF23_F GCATAGTCTCTCTGTCTGTCATCC
Reverse Primer: DF23_R AACCACCATTACGTGCATATACC
Reviews

Customers who bought this product also purchased
A13152
A13152
ZP179
ZP179
FGC20797
FGC20797
FGC20770
FGC20770
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
L513
L513
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies