Top » Catalog » SNPs » FGC6540

$18.00

FGC6540
[FGC6540]

FGC6540
hg38 Position: ChrY:7236221..7236221
Ancestral: C
Derived: T
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a2a1a2c1a (not listed)
Comments: Found in a R1b-DF49 person and HG02501 (R-Z2961)
Forward Primer: FGC6540_F TTACTGTAACCACTGCCTCCTG
Reverse Primer: FGC6540_R TGACGGAGTTATGCAAAAGAAG
Reviews

Customers who bought this product also purchased
A13152
A13152
ZP179
ZP179
FGC20797
FGC20797
Z39589
Z39589
DF13
DF13
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies