Top » Catalog » SNPs » FGC6540

$18.00

FGC6540
[FGC6540]

FGC6540
hg38 Position: ChrY:7236221..7236221
Ancestral: C
Derived: T
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a2a1a2c1a (not listed)
Comments: Found in a R1b-DF49 person and HG02501 (R-Z2961)
Forward Primer: FGC6540_F TTACTGTAACCACTGCCTCCTG
Reverse Primer: FGC6540_R TGACGGAGTTATGCAAAAGAAG
Reviews

Customers who bought this product also purchased
ZP44
ZP44
Z39589
Z39589
DF13
DF13
L21
L21
ZP81
ZP81
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies