Top » Catalog » SNPs » FGC6540

$18.00

FGC6540
[FGC6540]

FGC6540
HG19 Position: ChrY:7104262..7104262
Ancestral: C
Derived: T
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a2a1a2c1a (not listed)
Comments: Found in a R1b-DF49 person and HG02501 (R-Z2961)
Forward Primer: FGC6540_F TTACTGTAACCACTGCCTCCTG
Reverse Primer: FGC6540_R TGACGGAGTTATGCAAAAGAAG
Reviews

Customers who bought this product also purchased
FGC9645
FGC9645
ZP44
ZP44
Z39589
Z39589
DF13
DF13
L21
L21
ZP81
ZP81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies