Top » Catalog » SNPs » Z2961

$18.00

Z2961
[Z2961]

Z2961
hg38 Position: ChrY:7987211..7987211
Ancestral: C
Derived: T
Reference: David Reynolds (2012)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a
Comments: Downstream DF23. Upstream M222
Forward Primer: Z2961_F AGCAAAGGAGGATGCAACAC
Reverse Primer: Z2961_R AATTCCATCGACCAAACAGC
Reviews

Customers who bought this product also purchased
A13152
A13152
ZP179
ZP179
FGC20797
FGC20797
ZP81
ZP81
FGC9645
FGC9645
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies