Top » Catalog » SNPs » Z2976

$18.00

Z2976
[Z2976]

Z2976
hg38 Position: ChrY:13882542..13882542
Ancestral: C
Derived: G
Reference: David Reynolds (2012)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a
Comments: Downstream of Z2980
Forward Primer: Z2976_F CCACAGGCACATGACACC
Reverse Primer: Z2976_R GCTCATTGTAATAACCCAGAATAATG
Reviews

Customers who bought this product also purchased
ZP179
ZP179
FGC20797
FGC20797
A13152
A13152
ZP81
ZP81
FGC9645
FGC9645
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies