Top » Catalog » SNPs » ZP44

$18.00

ZP44
[ZP44]

ZP44
hg38 Position: ChrY:16997710..16997710
Ancestral: A
Derived: C
Reference: Peter Op den Velde Boots (R-Z18 Project) (2015)
ISOGG Haplogroup: R1b1a2a1a2c1a (not listed)
Comments: Downstream of Z2980
Forward Primer: ZP44_F CAGGGAGAGGCCAGTAAGAC
Reverse Primer: ZP44_R CCACTTCACTCGGCCTAAAC
Reviews

Customers who bought this product also purchased
Z39589
Z39589
DF49
DF49
DF13
DF13
ZP81
ZP81
L21
L21
FGC9645
FGC9645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies