Top » Catalog » SNPs » S310

$18.00

S310
[S310]

S310
HG19 Position: ChrY:14515450..14515450
Ancestral: C
Derived: T
Reference: Jim Wilson
ISOGG Haplogroup: R1b1a2a1a2c1i1
Comments: Aka L746
Forward Primer: S310_F TTCCTAGGTTTTCTTCTCGAGTTG
Reverse Primer: S310_R CCTCAAGTGATCCACCCAAC
Reviews (1)

Customers who bought this product also purchased
A889
A889
S768
S768
A5023
A5023
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
A919
A919
S781
S781
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies