Top » Catalog » SNPs » S310

$18.00

S310
[S310]

S310
hg38 Position: ChrY:12403651..12403651
Ancestral: C
Derived: T
Reference: Jim Wilson
ISOGG Haplogroup: R1b1a1a2a1a2c1i1a
Comments: Aka L746
Forward Primer: S310_F TTCCTAGGTTTTCTTCTCGAGTTG
Reverse Primer: S310_R CCTCAAGTGATCCACCCAAC
Reviews (1)

Customers who bought this product also purchased
S781
S781
A306
A306
A922
A922
A889
A889
S768
S768
A5023
A5023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies