Top » Catalog » SNPs » S592

$18.00

S592
[S592]

S592
hg38 Position: ChrY:17205019..17205019
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream S595
Forward Primer: S592_F AAATTACCTGACATGTGCTATTGG
Reverse Primer: S592_R TTCAACCTGTTCATCTTTTTCATG
Reviews

Customers who bought this product also purchased
FGC4113
FGC4113
A1743
A1743
Z2980
Z2980
DF49
DF49
S595
S595
F1265
F1265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies