Top » Catalog » SNPs » BY205

$18.00

BY205
[BY205]

BY205
hg38 Position: ChrY:8357336..8357336
Ancestral: G
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream S7814
Forward Primer: BY205_F TTAGCAGGACGCAGATAGGAG
Reverse Primer: BY205_R CTTGTAGGTTTCAGTGGTTTGC
Reviews

Customers who bought this product also purchased
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A13155
A13155
F1265
F1265
S603
S603
S588
S588
S659
S659
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies