Top » Catalog » SNPs » BY205

$18.00

BY205
[BY205]

BY205
hg38 Position: ChrY:8357336..8357336
Ancestral: G
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream S7814
Forward Primer: BY205_F TTAGCAGGACGCAGATAGGAG
Reverse Primer: BY205_R CTTGTAGGTTTCAGTGGTTTGC
Reviews

Customers who bought this product also purchased
F1265
F1265
S603
S603
S588
S588
S659
S659
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A13155
A13155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies