Top » Catalog » SNPs » BY250

$18.00

BY250
[BY250]

BY250
hg38 Position: ChrY:7178247..7178247
Ancestral: A
Derived: G
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a2c1a1a2
Comments: Downstream of CTS9219
Forward Primer: BY250_F CTGCAAAAGAAGTAAGAACTGAGTCTC
Reverse Primer: BY250_R ATGCTACTGGGGACACATGAG
Reviews

Customers who bought this product also purchased
Z2109
Z2109
Y38317
Y38317
Y11813
Y11813
Y33200
Y33200
M343
M343
L151
L151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies