Top » Catalog » SNPs » BY251

$18.00

BY251
[BY251]

BY251
hg38 Position: ChrY:22334835..22334835
Ancestral: T
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a2c1a1a2~
Comments: Downstream of CTS9219
Forward Primer: BY251_F TTTGTATAACTGCTCCAAAAGCAC
Reverse Primer: BY251_R GTGTTTTTCTCCCAAATATTCTTCAG
Reviews

Customers who bought this product also purchased
Z2103
Z2103
Y19971
Y19971
Y23493
Y23493
BY20218
BY20218
Y15982
Y15982
Y28788
Y28788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies