Top » Catalog » SNPs » BY251

$18.00

BY251
[BY251]

BY251
hg38 Position: ChrY:22334835..22334835
Ancestral: T
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a2c1a1a2~
Comments: Downstream of CTS9219
Forward Primer: BY251_F TTTGTATAACTGCTCCAAAAGCAC
Reverse Primer: BY251_R GTGTTTTTCTCCCAAATATTCTTCAG
Reviews

Customers who bought this product also purchased
FT49932
FT49932
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
P312
P312
BY199059
BY199059
M343
M343
BY105603
BY105603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies