Top » Catalog » SNPs » BY251

$18.00

BY251
[BY251]

BY251
hg38 Position: ChrY:22334835..22334835
Ancestral: T
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a2c1a1a2~
Comments: Downstream of CTS9219
Forward Primer: BY251_F TTTGTATAACTGCTCCAAAAGCAC
Reverse Primer: BY251_R GTGTTTTTCTCCCAAATATTCTTCAG
Reviews

Customers who bought this product also purchased
M343
M343
L145
L145
P38
P38
U106
U106
M173
M173
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies