Top » Catalog » SNPs » Y5587

$18.00

Y5587
[Y5587]

Y5587
hg38 Position: ChrY:19825197..19825197
Ancestral: A
Derived: G
Reference: YFull
ISOGG Haplogroup: R1b1a1a2a2c1a1a1
Comments: Downstream of CTS9219
Forward Primer: Y5587_F GTGTCCATTTAATCTTTGGCATAC
Reverse Primer: Y5587_R GCATTTTTAACAGATGTGTATTTTGC
Reviews

Customers who bought this product also purchased
Z282
Z282
A366
A366
R1a Superclade Panel
R1a Superclade Panel
CTS9416
CTS9416
L62
L62
M198
M198
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies