Top » Catalog » SNPs » A776

$18.00

A776
[A776]

A776
hg38 Position: ChrY:15396120..15396120
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A776_F AGCCCCAAGATGTCACATG
Reverse Primer: A776_R CTCTGTAAAACACGCATTGCTG
Reviews

Customers who bought this product also purchased
A772
A772
A778
A778
A777
A777
A773
A773
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies