Top » Catalog » SNPs » A779

$18.00

A779
[A779]

A779
hg38 Position: ChrY:8203994..8203994
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b1b1a1b1a6 (not listed)
Comments: Downstream L540
Forward Primer: A779_F GCTTAAACCAACTTTCCTCAGAAG
Reverse Primer: A779_R GCTTTTACGCTGTCAGTGAGC
Reviews

Customers who bought this product also purchased
A780
A780
A782
A782
A781
A781
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies