Top » Catalog » SNPs » A781

$18.00

A781
[A781]

A781
hg38 Position: ChrY:11925040..11925040
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b1b1a1b1a6 (not listed)
Comments: Downstream L540. SNP is in poly A homopolymer.
Forward Primer: A781_F CAGATATGGAGGCGCACAC
Reverse Primer: A781_R TTCCTTGCTTTTCAGGGATG
Reviews

Customers who bought this product also purchased
A779
A779
A782
A782
A780
A780
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies