Top » Catalog » SNPs » Y3

$18.00

Y3
[Y3]

Y3
hg38 Position: ChrY:15689178..15689178
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a (not listed)
Comments: Found from public sources aka F2597. Below Z94 and above L657.
Forward Primer: Y3_F CAACGATGTCAGAAGAAACAGC
Reverse Primer: Y3_R TGCATACCACAAGGGAAAAG
Reviews

Customers who bought this product also purchased
L657
L657
FGC30901
FGC30901
Y9
Y9
CTS2887
CTS2887
Z2124
Z2124
YP294
YP294
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies